Иван Р предлагает Вам запомнить сайт «Быть умным - это модно»
Вы хотите запомнить сайт «Быть умным - это модно»?
Да Нет
×

Основная статья: Биология

Добро пожаловать в ксенобиологию

Синтетические биологи между делом создали новое царство организмов — первых настоящих Чужих. Эта история начинается с телефонной пресс-конференции Джорджа Чёрча и Фаррена Айзекса — двух синтетических биологов из Гарварда и Йеля. Группы Чёрча и Айзекса придумали, как «посадить на поводок» генетически модифицированные организмы (сначала кишечную палочку E. coli, а в перспективе, возможно, и вообще все, что мы научились использовать в своих целях). Ученые, опубликовавшиеся в Nature, для этого подменили у E. coli генетический код — то есть сам способ, которым в ДНК закодирована информация. Не просто переписали геном, а присвоили его буквам новые значения. Технология редактирования ДНК под названием CRISPR/Cas, которой они воспользовались, по своим возможностям напоминает магию. Но в том, что получилось, магии еще больше.

Один из 64 кодонов — трехбуквенных сочетаний из нуклеотидов, составляющих словарный запас, если хотите, ДНК и РНК, — у этой версии кишечной палочки вместо сигнала об окончании синтеза белка теперь обозначает искусственную аминокислоту. Без этой аминокислоты такая E. coli не выживет: по крайней мере, в экспериментах групп на этой стадии шансы на «побег» путем случайной мутации, подбора подходящего аналога или заимствования генов у товарищей оценивались в один на триллион.

Пока я слушала пресс-конференцию и размышляла, когда же кто-нибудь из коллег наконец произнесет слова «Парк юрского периода» (где все началось с утечки ДНК из лаборатории), речь зашла о том, что по поводу таких инновационных организмов имеет сказать условный Роспотребнадзор, то есть всевозможные регуляторы. Пока немного, ответил Джордж Чёрч и дальше произнес ключевую лично для меня фразу: «Это ведь, по сути, не просто новый вид живых организмов, а что-то вроде нового царства, совершенно новая ветвь жизни».


Чем дальше, тем все более чужими эти организмы будут для всей остальной жизни на Земле.

Иными словами, добро пожаловать в ксенобиологию. Так называют науку об инопланетной жизни: «ксенос» — это, как известно, «чужой», привет Ридли Скотту. Статья о ней в Википедии, к слову, оптимистично сообщает, что, поскольку настоящих ксенобиологических организмов в ближайшие пару лет не видать, у лиц, принимающих решения, есть еще в запасе кое-какое время на то, чтобы разобраться, какие же именно решения принимать. Думаю, желающие могут смело пойти и обновить, а то как-то уже неловко выходит, по-моему.

Но на практике ксенобиология — это не дисциплина из арсенала корпорации зла Weyland—Yutani, придуманной Ридли Скоттом, а вполне реальное направление в синтетической биологии, которое изучает жизнь, говорящую на чуть-чуть ином генетическом языке. Языковую аналогию вслед за самими учеными выбрали многие журналисты, написавшие о новых результатах Чёрча и Айзекса. По словам исследователей, переназначение даже одного из 64 кодонов уже защищает эти rE. coli — за recoded (перекодированными) бактериями закрепилось такое название — от многих вирусов. Кроме того, это мешает горизонтальному переносу генов (через который «дикая» кишечная палочка, по некоторым данным, могла получить до двух третей всего своего пангенома — множества всех имеющихся в пределах вида генов).

На следующем этапе ученые переписывают уже семь из 64 кодонов — чем дальше, тем все более чужими эти организмы будут для всей остальной жизни на Земле. Напоминает классический парадокс корабля Тесея: сгнила доска — заменили, потом еще одну, и так до самой последней; тот ли это корабль, что вышел в плавание? До такого дело вряд ли дойдет, но с какого-то момента «языки» действительно станут настолько разными, что общаться, то есть передавать друг другу генетическую информацию, их носители не смогут вовсе.


Если пиджин становится первым языком у детей его изобретателей, он за одно поколение может превратиться в самостоятельный и полноценный язык.

(По чудесной иронии судьбы, как раз к этому моменту в тексте я начала ходить на очень интересный лингвистический курс MIT об усвоении первого языка. На первом же занятии разговор зашел о процессе креолизации как рождения нового языка под давлением обстоятельств. Если грубо, то когда в одном месте оказываются носители разных языков, которым тем не менее очень надо регулярно общаться, возникает пиджин — как бы недоязык, простенькая экспромт-помесь исходных компонентов. Но вот если пиджин становится первым языком у детей его изобретателей, он за одно поколение может превратиться в самостоятельный и полноценный язык. Скорее всего, я была единственным человеком в аудитории, который в течение всего этого обсуждения никак не мог отделаться от мыслей об одной там кишечной палочке.)

Синтетическая биология — дело относительно новое, можно сказать, наука нынешнего века, хотя разговоры о ней осторожно начинались еще в 1970—1980-х годах. На ее передовой находятся в том числе и люди, с которых все по-настоящему и началось, вроде того же Джорджа Чёрча. Соответственно, помимо самой дисциплины не менее бурно и на ходу развивается и ее этика. Показательно, что одна из популярных антологий по вопросам синтетической биологии и морали начинается с истории всего-то 2010 года: группа Крейга Вентера тогда представила миру «Синтию», клетку с искусственным геномом, в который помимо имен и электронных адресов исследователей попали даже вдохновляющие цитаты о науке.

В эту глубокомысленную подборку попал и Йоахим Больдт, специалист по медицинской этике и биоэтике из Фрайбургского университета, с таким вот рассуждением. Химия безупречно доказала, что преуспела в анализе соединений, посредством успехов в их синтезе. А синтетическая биология «пытается представить итоговый анализ жизни: показать, что биологические организмы можно объяснить через их составные части — через ее, жизни, синтез». Вместе с тем Больдт предостерегает от чрезмерного увлечения громкими описаниями вроде творения, «создания жизни» или «природы 2.0»: пока, по его словам, мы в основном манипулируем исходным материалом, а не создаем что бы то ни было с нуля. Так что зазнаваться особенно не стоит, как бы говорит он Вентеру, который в геноме своей «Синтии» процитировал Ричарда Фейнмана: чего не могу создать, того не понимаю.

Зазнаваться действительно опасно, когда в соседних кабинетах с синтетическими биологами — иногда и в прямом смысле — старательно ищут контекст для жизни, какой мы ее знаем, астрономы. (А ведь еще где-то рядом ищут невиданные доселе живые организмы в подледных озерах Антарктики и пытаются создать искусственный интеллект, вовсю называя его искусственной жизнью, кстати.)
В ДНК «Синтии», первой в мире клетки с искусственным геномом, Крейг Вентер закодировал цитату из Ричарда Фейнмана: «Чего не могу создать, того не понимаю».

Собственно, сама фраза «контекст для жизни» в этот текст попала из лекции Дэвида Шарбонно, знаменитого специалиста по экзопланетам. Он в нынешнем году начал вести в Гарварде свежий курс по этой теме — без сомнения, ничуть не менее популярной у соответствующих студентов, чем синтетическая биология. В целом вопрос поиска внеземной жизни во Вселенной уверенно переезжает из Солнечной системы, где, по-видимому, если что-то еще и было, то уже кончилось (хотя всем все равно интересно), за ее пределы. И чем больше ученые находят экзопланет, особенно похожих на Землю, тем больше их уверенность в том, что на одной такой планете рано или поздно найдется то, что они ищут.

Астрономы — единственные, кто ищет по-настоящему независимое творение, говорит Шарбонно. Если мы найдем жизнь на планете, вращающейся вокруг другой звезды, нет никаких шансов, что эта жизнь будет хоть как-то нам родственна и мы будем иметь к ней хотя бы сколько-нибудь отдаленное отношение. Все остальные либо все-таки пытаются разобраться в жизни на Земле, либо, как в случае с искусственным интеллектом, откровенно творят по своему образу и подобию, считает ученый.

В отличие от своих ксеноколлег, астробиологи в обозримом будущем пощупать свой контекст для жизни не смогут: по словам Шарбонно, не очень-то и понятно, действительно ли астрономические инструменты следующего поколения — например, «Джеймс Уэбб» — смогут обнаружить в атмосферах планет за пределами Солнечной системы следы присутствия жизни. Но первую экзопланету уверенно открыли только в 1992 году, то есть временные горизонты и скорость развития у двух дисциплин сопоставимы. А углеродный шовинизм, в котором часто обвиняют астробиологов (идея, что настоящая жизнь может возникнуть только из биомолекул, химически похожих на земные, а «кремниевой», «плазменной» или «цифровой» быть не может), ничуть не чужд и их синтетическим товарищам, поэтому в качестве аргумента в чью-то пользу не принимается.

Так что до финишной линии пока далеко.

10 фев 15, 07:15
0 0

Какого цвета инфузория-туфелька?


Рисунок © Е.В.
Инфузории-туфельки (Paramecium)– крупный род, в его состав входит несколько десятков видов.
Большинство видов туфелек бесцветные. Один из видов (Paramecium bursaria) имеет внутриклеточных симбионтов — одноклеточных водорослей-зоохлорелл. Они придают клеткам туфелек зеленую окраску. Некоторые виды туфелек могут синтезировать гемоглобин — красный пигмент, связывающий кислород. Тогда они приобретают розоватую окраску.
Разную окраску могут иметь пищеварительные вакуоли туфелек — их цвет зависит от состава пищи. А еще туфелек нередко подкрашивают с помощью разных витальных (прижизненных) красителей, чтобы за ними было легче наблюдать в микроскоп.

источник

9 ноя 14, 07:00
0 0

Почему у человека некоторые органы — парные (например, легкие, почки), а другие — в одном экземпляре?



Иллюстрация, показывающая различные типы симметрий, существующие на Земле. Демонстрируется в Музее естественной истории имени Филда в Чикаго, США
Иллюстрация, показывающая различные типы симметрий, существующие на Земле. Демонстрируется в Музее естественной истории имени Филда в Чикаго, США. Здесь показаны и те виды симметрии, которые не были описаны в этой статье, поскольку не встречаются у человека (например, спиральная симметрия раковин моллюсков). Изображение с сайта en.wikipedia.org
Вначале попробуем ответить на вспомогательный вопрос: почему у человека некоторые части тела симметричны, а другие — нет?


Симметрия — базовое свойство большинства живых существ. Быть симметричным очень удобно. Подумайте сами: если у вас со всех сторон есть глаза, уши, носы, рты и конечности, то вы успеете вовремя почувствовать что-то подозрительное, с какой бы стороны оно ни подкрадывалось, и, в зависимости от того, какое оно, это подозрительное, — съесть его или, наоборот, от него удрать.
Самая безупречная, «самая симметричная» из всех симметрий — сферическая, когда у тела не отличаются верхняя, нижняя, правая, левая, передняя и задняя части, и оно совпадает само с собой при повороте вокруг центра симметрии на любой угол. Однако это возможно только в такой среде, которая сама идеально симметрична во всех направлениях и в которой со всех сторон на тело действуют одни и те же силы. Но на нашей земле подобной среды нет. Существует по крайней мере одна сила — сила тяжести, — которая действует только по одной оси (верх-низ) и не влияет на остальные (вперед-назад, вправо-влево). Она всё тянет вниз. И живым существам приходится к этому приспосабливаться.
Так возникает следующий тип симметрии — радиальная. У радиально-симметричных существ есть верхняя и нижняя части, но правой и левой, передней и задней нет. Они совпадают сами с собой при вращении только вокруг одной оси. К ним относятся, например, морские звезды и гидры. Эти создания малоподвижны и занимаются «тихой охотой» за проплывающей мимо живностью.
Актинии (морские анемоны) — пример радиально симметричных организмов. Рисунок из <a href=книги Эрнста Геккеля «Красота форм в природе»" border="0" height="855" src="http://mtdata.ru/u12/photo670F/20313031093-0/original.jpg#20313031093" width="600" />
Актинии (морские анемоны) — пример радиально симметричных организмов. Рисунок из книги Эрнста Геккеля «Красота форм в природе». Изображение с сайта en.wikipedia.org
Но если какое-то существо собирается вести активный образ жизни, гоняясь за жертвами и удирая от хищников, для него приобретает важность еще одно направление — передне-заднее. Та часть тела, которая находится впереди, когда животное двигается, становится более значимой. Сюда «переползают» все органы чувств, а заодно и нервные узлы, которые анализируют полученную от органов чувств информацию (у некоторых счастливчиков эти узлы потом превратятся в головной мозг). К тому же, спереди должен находиться рот, чтобы успеть ухватить настигнутую добычу. Всё это обычно располагается на отдельном участке тела — голове (у радиально-симметричных животных головы нет в принципе). Так возникает билатеральная (или двусторонняя) симметрия. У билатерально-симметричного существа отличаются верхняя и нижняя, передняя и задняя части, и только правая и левая идентичны и являются зеркальным отображением друг друга. Этот тип симметрии характерен для большинства животных, включая и человека.
«Витрувианский человек» Леонардо да Винчи показывает пример билатеральной симметрии
«Витрувианский человек» Леонардо да Винчи показывает пример билатеральной симметрии. Изображение с сайта en.wikipedia.org
У некоторых животных, например у кольчатых червей, помимо билатеральной есть и еще одна симметрия — метамерная. Их тело (за исключением самой передней части) состоит из одинаковых члеников-метамеров, и если сдвигаться вдоль тела, червь сам с собой «совпадает». У более развитых животных, включая человека, сохраняется слабое «эхо» такой симметрии: в каком-то смысле, наши позвонки и рёбра тоже можно назвать метамерами.
Человеческие ребра имеют некоторые черты метамерной симметрии
Человеческие ребра имеют некоторые черты метамерной симметрии. First thoracic — первый грудной позвонок, first lumbar — первый поясничный. Изображение с сайта ru.wikipedia.org
Итак, почему у человека есть парные органы, мы разобрались. Теперь обсудим, откуда взялись непарные.
Для начала попробуем понять: что же является осью симметрии для самых простых, радиально симметричных, примитивных многоклеточных? Ответ простой: это пищеварительная система. Вокруг нее и выстраивается весь организм, и организован он так, чтобы каждая клеточка тела находилась близко к «кормушке» и получала достаточное количество питательных веществ. Представим себе гидру: ее рот симметрично окружен щупальцами, которые загоняют туда добычу, а кишечная полость находится в самой середине организма и является осью, вокруг которой формируется всё остальное тело. Пищеварительная система у таких существ одна по определению, потому что «под нее» и выстраивается весь организм.
Постепенно животные усложнялись, и их пищеварительная система тоже становилась всё более совершенной. Кишечник удлинился, чтобы более эффективно переваривать пищу, и поэтому ему пришлось сложиться в несколько раз, чтобы поместиться в брюшной полости. Появились дополнительные органы — печень, желчный пузырь, поджелудочная железа, — которые расположились в организме асимметрично и «подвинули» некоторые другие органы (например, из-за того, что печень расположена справа, правая почка и правый яичник/яичко сдвинуты вниз относительно левого). У человека изо всей пищеварительной системы только рот, глотка, пищевод и анальное отверстие сохранили свое положение на плоскости симметрии организма. Но пищеварительная система и все ее органы так и остались у нас в единственном экземпляре.
Теперь посмотрим на кровеносную систему.
Если животное маленькое, у него нет проблемы с тем, чтобы питательные вещества дошли до каждой клеточки, — ведь все клетки находятся достаточно близко к пищеварительной системе. Но чем больше живое существо, тем острее для него возникает проблема доставки питания до «отдаленных провинций», находящихся на большом расстоянии от кишечника, на периферии тела. Появляется потребность в чём-то, что «кормило» бы эти участки, а кроме этого, соединяло всё тело воедино и позволяло далеко расположенным регионам «общаться» между собой (а у некоторых животных также разносило бы кислород от органов дыхания по всему телу). Так появляется кровеносная система.
Кровеносная система выстраивается вдоль пищеварительной, и поэтому состоит она, в самых примитивных случаях, всего лишь из двух главных сосудов — брюшного и спинного — и нескольких соединяющих их дополнительных. Если существо маленькое и слабоподвижное (как, например, ланцетник), то для того, чтобы кровь двигалась по сосудам, достаточно сокращения самих этих сосудов. Но относительно крупным существам, ведущим более активный образ жизни (например, рыбам), этого мало. Поэтому у них часть брюшного сосуда превращается в специальный мышечный орган, с силой толкающий кровь вперед, — сердце. Поскольку оно возникло на непарном сосуде, то и само оно «одинокое» и непарное. У рыб сердце симметрично само по себе и в теле располагается на плоскости симметрии. Но у наземных животных, в связи с появлением второго круга кровообращения, левая часть сердечной мышцы становится больше правой, и сердце сдвигается в левую сторону, теряя и симметричность своего положения, и свою собственную симметрию.

Источник

2 ноя 14, 06:00
0 0

Почему животные не улыбаются



Рис. © Е.В.
Уже не первый раз мне попадается вопрос, который приходится «перевернуть с головы на ноги»: на самом деле животные улыбаются и даже смеются. Поэтому правильнее была бы такая форма вопроса: «Почему животные и люди улыбаются и смеются?».

На этот вопрос я и попробую ответить. Должен только предупредить: по поводу природы смеха человека написаны тома. Поэтому на исчерпывающий ответ читателю не стоит рассчитывать. В основном я расскажу о точке зрения сравнительной этологии (науки о поведении животных) на природу улыбки и смеха.

А улыбка ли это?

Очень важный отправной пункт — договориться, что можно считать у животных улыбкой или смехом. За эталон сравнения мы берем человеческую улыбку и человеческий смех. В биологии одинаковыми терминами принято называть гомологичные структуры — например, органы, которые уже имелись у общих предков сравниваемых видов. Скажем, гомологичны друг другу (как передние конечности) крыло птицы и рука человека. Кроме органов, гомологичными могут быть и унаследованные от общих предков гены. Очевидно, что кроме органов и генов могут быть гомологичными и многие формы поведения — они ведь тоже наследуются.
Для органов хорошо разработаны критерии, помогающие установить их гомологию (см., например, соответствующую статью в Википедии). Для генов такой критерий — сходство их нуклеотидных последовательностей. Но как же установить, гомологичны ли улыбка человека и оскал зубов шимпанзе или собаки? Может быть, они только внешне похожи? Даже если они демонстрируются в сходных ситуациях и выполняют похожую роль, они вполне могли возникнуть независимо (биологи называют такие признаки аналогичными). Тогда обезьянью «улыбку», конечно, можно так называть (как мы называем крылом и крыло птицы, и крыло бабочки) — но всё-таки надо помнить, что это нечто совсем другое, чем человеческая улыбка.
Однако некоторые критерии, разработанные для выяснения гомологии органов, годятся и при определении гомологии форм поведения. Так, если, при всём несходстве форм поведения у двух видов, между этими двумя формами можно найти ряд промежуточных форм поведения у других, родственных видов, то это сильный довод в пользу их гомологии (см. Критерий переходных форм). Если за две формы поведения отвечают сходные цепи нейронов мозга — это тоже довод в пользу их гомологии (например, гомологичен чесательный рефлекс у всех наземных позвоночных — от лягушек до собак). Сейчас появились и другие возможности устанавливать гомологию поведенческих актов. Даже не зная точных нейронных цепей, можно установить, какие участки мозга активируются при том или ином поведении (для этого используют, например, позитронно-эмиссионную томографию). Иногда удается даже узнать, какие гены отвечают за конкретную форму поведения — например, какие из них начинают активнее работать и производить белки при определенной форме поведения.
Так вот, с помощью разных методов установлено, что орангутаны, шимпанзе и гориллы точно и улыбаются, и смеются. Вероятно, улыбаются и смеются собаки. Что совсем уж неожиданно — почти наверняка смеются крысы. Когда это открыли, ученые долго не хотели этому верить. Но сейчас это общепризнанный факт.

Покажем друг другу зубы!

Младенцы начинают улыбаться даже в том случае, если родились глухими и слепыми. У нормальных младенцев так называемая «социальная улыбка» появляется к концу первого месяца жизни в ответ на вид человеческого лица (или его нарисованной схемы). Эти данные показывают, что улыбка — врожденная форма поведения (хотя впоследствии и регулируется произвольно).
То же можно сказать и о смехе. Такие врожденные формы поведения человека почти всегда можно найти и у его ближайших родственников, приматов.
И люди, и животные улыбаются, когда хотят продемонстрировать друг другу дружелюбие. При этом улыбка — оскаленные зубы! — вроде бы должна восприниматься как угроза. И действительно, бывает ведь «зловещая улыбка», «издевательский смех» или «торжествующий смех» победителя над побежденным. Но обычная улыбка воспринимается прямо противоположным образом — как «дружелюбный оскал». Показывая зубы, улыбающийся как бы говорит адресату: «Вот как я мог бы с тобой поступить, но не поступлю!» (эту идею высказал великий этолог Конрад Лоренц). Так что улыбка — это ритуализованная угроза, превращенная в приветствие. Еще можно было бы назвать ее «укус без укуса». Между улыбкой и укусом есть и промежуточные формы поведения: например, при «игре со щекоткой» (см. ниже) щенки и многие дети в возрасте 2–3 лет демонстрируют, кроме улыбки и смеха, «игровые» укусы.
Смех животные чаще всего используют при шуточном нападении — например, при игре, когда партнеры щекочут друг друга или один щекочет другого. (Почти всегда в этой ситуации смеются и люди.) Человекообразные обезьяны от щекотки издают звуки, довольно похожие на человеческий смех. В частности, звуки издаются и при вдохе, и при выдохе (у людей звуки обычно издаются на выдохе, а у человекообразных обезьян почти во всех случаях — только на вдохе). Интересно, что при смехе люди не произносят букв и слогов (ученые говорят, что при этом отсутствует артикуляция). Связано это прежде всего с тем, что при смехе работа центров речи у человека подавляется.
А вот смех крыс просто так услышать нельзя. Они смеются слишком тоненько — издают ультразвуки частотой 50 кГц. Обычно смеются крысята — во время игры или когда приглашают друг друга поиграть.

Зачем улыбки и смех нужны животным

Улыбки и смех характерны для социальных (общественных) животных, которые при драках могут нанести друг другу серьезные травмы. Как правило, они тормозят агрессию, служат средством умиротворения. В играх с шуточным нападением смех сигнализирует, что это — игра, что нападающий не будет кусаться по-настоящему. При этом очень важно, чтобы сигнал был понятен — недаром и люди самых разных культур обычно легко отличают искреннюю улыбку от угрожающего оскала. (Доказано, что лучше это получается у «изгоев», которым особенно важно наладить контакт с соплеменниками; см. Чтобы отличить искреннюю улыбку от поддельной, нужно стать изгоем, «Элементы», 27.11.2008.)
Конечно, у людей (а может быть, и у животных) улыбка и смех могут выполнять множество других функций (прочитать о них можно, например, в книге А. Г. Козинцева. Человек и смех). Я упомяну только о нескольких из них.
С часто смеющимися крысами охотнее общаются и играют их сородичи. Яак Панксепп (Jaak Panksepp), открывший смех у крыс, так описывает его возможные функции: «Смех — признак хорошего характера и умения ладить с окружающими; поэтому часто смеющиеся крысы воспринимаются как хорошие партнеры для игр, а такие игры иногда могу кончаться и размножением. Смех — признак психического здоровья, как пышный хвост павлина — признак его физического здоровья». То есть предполагается, что смех играет роль при половом отборе. Кажется вполне правдоподобным, что и юмор у людей развился под действием полового отбора (см., например, Чувство юмора и щедрость — результаты полового отбора?, «Элементы», 18.12.2008).
Показано, что частота смеха у крыс — хороший показатель не только психического, но и физического здоровья. Видимо, связь здесь двусторонняя: «довольные» крысы чаще смеются, но и сам частый смех полезен для здоровья. Человека это тоже касается. И у человека, и у животных в одни и те же, достаточно древние, отделы мозга «впечатаны» основные эмоции. К ним можно отнести и удовольствие. Когда животное получает положительные стимулы (например, ест вкусную пищу), включается «система вознаграждения». Активируются определенные нейроны, выделяющие нейромедиатор дофамин. По-видимому, животные, как и люди, испытывают при этом положительные эмоции. Так вот, эта система включается и у людей, и у животных при смехе (даже от щекотки!). Чтобы их пощекотали, крысы готовы выполнять те же задания, что и для получения пищевой награды, — нажимать на рычаг или проходить лабиринт. При этом, по-видимому, при еде и при смехе в клетках мозга активируются похожие гены.
Недавно было показано, что другая популяция выделяющих дофамин нейронов в подкорковых структурах мозга реагирует не на положительные стимулы, а на новизну или неожиданные события. Интересно, что в таких ситуациях (например, попав в незнакомую клетку или встретившись с незнакомой крысой) крысы часто смеются! Возможно, их смех в таких ситуациях можно сравнить с «нервным смехом» у человека. А нервный смех часто помогает «разрядить эмоции» — например, после испуга или напряжения...Можно предположить, что подобные механизмы задействованы и в восприятии юмора — ведь часто шутки и анекдоты вызывают смех именно из-за неожиданного развития событий! Хотя, конечно, в восприятии юмора участвует и кора мозга.
Интересно, что дофамин выделяется даже тогда, когда мы улыбаемся «нарочно», то есть когда ничего радостного или смешного не происходит. Этот и многие другие примеры показывают, что не только «лицо — зеркало души», но и «душа — зеркало лица». Поразительно, как точно эти научные результаты предвосхитил философ И. Кант:
«Детей, особенно девочек, нужно в раннем возрасте приучать к непринужденному смеху, ибо веселое выражение лица постепенно отражается и на внутреннем мире и вырабатывает расположение к веселости, приветливости и благосклонности ко всем».
Почаще смешите своих детей — и нам всем станет веселее жить, когда они вырастут!

Источник

1 ноя 14, 06:00
0 0

Память воды

Что такое память воды?Что такое память воды?.. Все началось в одной из закрытых лабораторий Германии. Лаборантка случайно уронила в сосуд с дистиллированной водой запаянную ампулу с сильнодействующим ядом, и вода приняла смертельные свойства яда, не соприкасаясь с ним.
Позже учеными было доказано, что даже после полной химической очистки память воды сохраняет информацию обо всех веществах, находившихся в воде, в виде электромагнитных колебаний и эти колебания могут быть благотворными или отравляющими для любого организма.

Вода – это самое распространенное вещество на Земле. Тем не менее, можно сказать, что память воды еще полностью не изучена.

Но на рубеже 21-го века память воды была разгадана. Оказалось, что вода состоит из супермолекул, так называемых кластеров или ячеек. Эта структура меняется, если на воду воздействовать различными способами: химическим, электромагнитным, механическим. Под этими воздействиями ее молекулы способны перестраиваться и таким образом запоминать любую информацию. Память воды позволяет впитывать в себя, хранить и обмениваться с окружающей средой данными которые несет свет, мысль, музыка, молитвы или простое слово. Подобно тому, как каждая живая клетка хранит в себе сведения обо всем живом организме, память воды каждой ячейки способна хранить в себе информацию обо всей нашей планетарной системе.

Память воды состоит из ячеек, каждая из которых представляет собой минимальный компьютер. А если так, то человек, состоящий в основном из воды, представляет собой программируемую систему. Любые внешние факторы, в том числе и общения людей друг с другом, меняют структуру и биохимический состав жидких сред организма. Это происходит на клеточном уровне, программируется даже сама молекула ДНК вплоть до полного ее разрушения. Программа, основанная на молекулярном уровне, заложена в память воды и компьютер воды для каждого организма человека индивидуален. Возникает вопрос: воздействуем ли мы через память воды друг на друга своими мыслями, словами, такими чувствами как зависть, или любовь?
Способны ли мы программировать сами себя и окружающих? Безусловно, ученые подтвердили и это!

Духовный мир проявляет себя в материальном мире вполне конкретно. Японский ученый, доктор Э. Массаро замораживал капельки воды и затем изучал их под сильным микроскопом, имеющим встроенную фотокамеру. Его работа наглядно продемонстрировала различие в молекулярной структуре воды при ее взаимодействии с окружающей средой. Этот метод дал возможность показать, каким образом энергетические вибрации человека, мысли, слова, идеи и музыка воздействуют на память воды.
Получение красивых снежинок разной формы после "прослушивания" водой Моцарта, Шуберта или Бетховена – это еще один пример того, что различные факторы, которые влияют на память воды, меняют структуру воды таким образом, что кристаллизация происходит с другой фазовой траектории.

Когда мы мыслим, то структура той жидкости, которую мы при этом употребляем под эти мысли подстраивается. Не надо ничего пить с плохими мыслями – от этого будет только хуже. Духовно образованный человек всегда это помнит. Существует память воды, которая обменивается информацией со всей Вселенной и у нее есть очень важное сообщение для человечества. Она предлагает нам заглянуть глубже в нас самих.

Источник

27 окт 14, 12:30
0 0

Ландшафт приспособленности.





Биологи, изучающие эволюцию белков, используют образ громадного, но всё же конечного пространства последовательностей. Это воображаемое пространство включает все возможные "тексты", записанные 20-буквенным аминокислотным "алфавитом". Например, для белка длиной в 300 аминокислот существует 20^300 возможных последовательностей. По сравнению с этим числом количество атомов во Вселенной (примерно 10^80) пренебрежимо мало.

Каждая точка в пространстве последовательностей соответствует одному белку, а расстояние между точками отражает степень различий между двумя белками. Эволюцию белковой молекулы можно представить как движение в пространстве последовательностей.

Каждой функции, выполняемой белками, соответствует некая область в пространстве последовательностей, в пределах которой любая точка - это белок, способный справиться с данной функцией. До тех пор пока эволюция белка идёт без смены функции, его движение ограничено этой областью.

Главный вопрос в том, насколько велики такие области и какова их структура. Теоретически они могут быть как сплошными полями, так и лабиринтами узких тропинок, разделённых "запретными зонами".

Полезным дополнением к образу пространства последовательностей является образ ландшафта приспособленности, введённый в употребелние в 1932 году выдающимся американским генетиком Сьюэлом Райтом (1889-1988). Каждой точке пространства последовательностей соответствует та или иная величина приспособленности. Если речь идёт об аминокислотной последовательности белка, то приспособленность можно понимать как эффективность выполнения белком своей функции. Если речь идёт о нуклеотидной последовтельности генома, то приспособленность - это эффективность размножения организма с таким геномом. Принято представлять области высокой приспособленности в виде возвышенностей, низкой - в виде долин или ям. При этом вышеупомянутые "поля" приобретают вид горных плато, "тропинки" становятся хребтами, а "запретные зоны" - долинами и пропастями. Вредные мутации - это движение вниз по склону, полезные - путь наверх. Мутации нейтральные, не влияющие на приспособленность, соответствуют движению вдоль горизонталей - линий одинаковой высоты. Отбраковывая вредные мутации, естественный отбор мешает эволюционирующей последовательности двигаться вниз по ландшафту приспособленности. Поддерживая мутации полезные, отбор пытается загнать последовательность как можно выше. Спуск в долины запрещён, потому что мутации, снижающие эффективность работы белка, отсеиваютс отбором. В результате белок может оказаться в "ловушке локального максимума", т.е. застрять на одной из второстепенных вершин. Популяция, поднявшаяся на маленький пик, не может сменить его на большой, стать более приспособленной, ибо при смене пиков отбор пойдет против уровня приспособленности. Так, кошка во время наводнения, спасаясь на низком заборе, может утонуть, хотя бы рядом был высокий дом. В конечном счете все вымершие группы (панцирные рыбы и динозавры, саблезубые тигры и мамонты) повинны перед эволюцией лишь в том, что выбрали неудачные, невысокие адаптивные пики.

Именно ловушки локальных максимумов известный биолог Р.Докинз выделяет в качестве одной из причин, препятствующей неограниченному усовершенствованию живых организмов: "Метафора «адаптивного ландшафта» Сьюэлла Райта (1932) отражает ту же идею – отбор в пользу локальных оптимумов (местных «пиков» приспособленности) предотвращает эволюцию в направлении глобальных оптимумов, в конечном счёте более значительных." (Ричард Докинз "Расширенный фенотип).

Источники: А.Марков, Е.Наймарк "Эволюция. Классические идеи в свете новых открытий"; Р.Докинз "Расширенный фенотип"; Б.Медников "Аксиомы биологии".

20 окт 14, 10:30
0 0

Хватит перевирать науку


Многие понятия покинули мир науки, и соответствующие слова стали частью повседневной речи — но, к сожалению, чаще всего их используют неправильно. Мы попросили нескольких ученых рассказать, какие научные термины, по их мнению, неправильно употребляются чаще всего. Вот десять из них.
Доказательство

Физик Шон Кэрролл стенает:

Я бы сказал, что «доказательство» — это самый неправильно понятый научный концепт. У него есть формальное толкование («логическая демонстрация того, что определенные последствия вытекают из определенных предпосылок»), и оно сильно расходится с бытовым употреблением слова, значение которого ближе к простому «свидетельство в пользу чего-либо». Между тем, что говорят ученые и что слышат обыватели, существует зазор, поскольку ученые ориентируются на более четкое определение, согласно которому наука никогда ничего не «доказывает»! Поэтому, когда нас спрашивают: «Как вы „докажете“, что люди произошли от других видов путем эволюции?» — или: «Можете ли вы „доказать“, что изменения климата вызваны деятельностью человека?», — мы обычно мнемся вместо того, чтобы просто сказать: «Конечно, можем». Тот факт, что на самом деле наука ничего не доказывает, а просто создает все более и более убедительные и понятные теории (которые тем не менее всегда можно и нужно улучшать и дополнять), — это одна из ключевых черт науки, определяющая ее успехи.
Теория

Астрофизик Дэйв Голдберг предлагает свою теорию по поводу слова «теория»:

Обычные люди (а также те, у кого есть на то идеологические причины) слышат слово «теория» и думают, что оно означает «идея» или «предположение». Но нам лучше знать. Научная теория — это целая система проверяемых и потенциально опровержимых идей; все они могут быть оспорены либо благодаря очевидным фактам, либо путем эксперимента, который можно провести. Лучшие теории (в том числе специальная теория относительности, теория квантовой механики и теория эволюции) выдержали сотню, а то и больше сотни лет постоянной критики и перепроверок — со стороны тех, кто хотел доказать, что они умнее Эйнштейна, или тех, для чьих воззрений эти теории представляли метафизическую угрозу.

Кроме всего прочего, теории изменчивы, но не до бесконечности. Они могут быть неполными, в них могут содержаться отдельные неточности, при этом теория в целом будет оставаться верной. Даже теория эволюции сильно изменилась за годы существования, но ее все еще можно узнать.

Проблема с фразой «Это всего лишь теория» — в том, что она заставляет считать, что настоящая научная теория — это какая-то мелочь. А это не так.
Квантовая неопределенность и квантовая запутанность

Голдберг добавляет, что есть и другие понятия, которые исковеркали даже больше, чем «теорию». Он имеет в виду употребление специальных физических терминов для описания духовного опыта и практик в стиле нью-эйдж:

Эта неверная трактовка — следствие использования понятий квантовой механики особой породой спиритуалистов и адептов концепции «помоги себе сам». Кратко она изложена в тошнотворном фильме «Что мы знаем?! Вниз по Кроличьей Норе». Квантовая механика, как известно, строится на измерении. Позиция наблюдателя, импульс и энергия могут вызвать непредсказуемый «коллапс волновой функции» (так, одна из моих первых колонок называлась «Насколько умным нужно быть, чтобы вызвать коллапс волновой функции?»). Но тот факт, что не все во Вселенной предопределено, не означает, что ты у руля. Удивляет (и, если честно, пугает), насколько тесно в определенных кругах связывают квантовую неопределенность и квантовую запутанность с идеей души или человеческого контроля над событиями или другими, такими же завиральными, предрассудками. В конце концов, мы состоим из квантовых частиц (протонов, нейтронов, электронов) и являемся частью квантовой Вселенной. Это круто, конечно, но только в том смысле, что физика — это вообще круто.
Врожденное против благоприобретенного

Эволюционный биолог Марлин Зак говорит:

Одна из моих любимых ошибок — это идея о том, что поведение может быть «врожденным» или «приобретенным» (и все вариации этого противопоставления). Первый вопрос, который мне обычно задают, если я заговариваю о поведении, это «генетическое» оно или нет — что само по себе уже признак непонимания, поскольку ВСЕ черты всегда являются результатом взаимодействия генов и среды. Только различие между чертами, а не черты сами по себе, могут быть генетическими или приобретенными. Например, если вы берете двух идентичных близнецов, воспитываете их в разных условиях и они делают что-то по-разному (например, говорят на разных языках), тогда различие приобретенное. Но владение французским языком, итальянским или любым другим не является полностью приобретенным, поскольку, очевидно, нужны определенные генетические условия для того, чтобы в принципе владеть даром речи.
Естественное

Биолог-синтетист Терри Джонсон ужасно устал от того, что люди неправильно понимают смысл этого слова:

«Естественный» и «натуральный» — это слова, которые используются в таком количестве контекстов и значений, что понять их собственный смысл представляется почти невозможным. Их самое банальное употребление — разграничение явлений, которые существуют только благодаря деятельности человека, и тех, которые могут возникать и без его участия. Оно предполагает, что люди каким-то образом отделены от природного мира, что наша жизнедеятельность «неестественна» по сравнению с жизнью, скажем, бобров или медоносных пчел.

Если говорить о еде, понятие «натуральный» еще более скользкое. В разных странах оно имеет разные значения. В США Управление по надзору за качеством продуктов и медикаментов махнуло рукой на осмысленное определение «натуральной еды» (в основном в пользу еще более зыбкого термина «органическая еда»). В Канаде я могу торговать кукурузой как «натуральным» продуктом, если ничего в нее не добавлял или не извлекал из нее перед продажей; однако кукуруза как таковая — это продукт длившейся тысячелетия культивации ее человеком, выведения ее из растения, которого без человеческого вмешательства не существовало бы.
Ген

Впрочем, еще больше Джонсона угнетает употребление слова «ген»:

25 ученым потребовалось два дня споров, чтобы породить следующее определение: «Ген — это локализуемый фрагмент геномной последовательности, соответствующий единице наследования, которая связывается с регулирующими, считывающими и/или другими функциональными фрагментами последовательности». Это означает, что ген — это отдельный фрагмент ДНК, на который мы можем указать и сказать: «Этот кусок за что-то отвечает или регулирует производство чего-то». Определение оставляет пространство для маневра; не так давно мы считали, что большая часть нашей ДНК вообще ничего не делает. Мы называли ее «мусорной ДНК», но вот сейчас обнаруживается, что значительная часть этого мусора обладает функциями, которые видны не с первого взгляда.

Обычно наиболее неправильное использование слова «ген» можно опознать по следующему за ним определению «для чего-то». Здесь есть две проблемы. У всех нас имеются гены для гемоглобина, но не у всех есть серповидно-клеточная анемия. У разных людей разные версии гена «для гемоглобина», называемые «аллели». Одни аллели гемоглобина связаны с развитием серповидно-клеточного заболевания, а другие — нет. Так что ген отсылает к семейству аллелей, и только некоторые члены этого семейства (если такие вообще есть) связаны с болезнями или нарушениями. Ген сам по себе не плох (поверьте, без гемоглобина вы долго не протянете), но частная версия гемоглобина, которая есть лично у вас, может вызывать проблемы.

Больше всего меня беспокоит популяризация идеи о том, что если генетическая вариация с чем-то коррелирует, то это и есть «ген для» чего-то. Подобным словоупотреблением говорящий предполагает, что «этот ген вызывает порок сердца», тогда как в реальности обычно «люди с этой аллелью более подвержены пороку сердца, но мы точно не знаем почему, и, возможно, эта аллель обладает компенсирующими преимуществами, которых мы не заметили, потому что не искали их».
Статистически значимый

Математик Джордан Элленберг хотел бы разъяснить недоразумение с этим понятием:

«Статистически значимый» — это одно из тех выражений, которые ученые хотели бы переформулировать, будь у них такая возможность. «Значимый» подразумевает важность; но тест на статистическую значимость, разработанный британским статистиком Рональдом Эйлмером Фишером, измеряет не важность или размеры какого-либо эффекта — а только то, можем ли мы, используя наши лучшие статистические инструменты, отличить его значение от нуля. «Статистически заметный» или «статистически различимый» было бы куда лучше.
Выживание наиболее приспособленного

Палеоэколог Жаклин Джилл говорит, что люди неверно трактуют одну из базовых идей теории эволюции:

Мой список возглавляет понятие «выживание наиболее приспособленного». Во-первых, сам Дарвин никогда ничего такого не утверждал. Во-вторых, люди неверно понимают выражение «наиболее приспособленный». В связи с этим сбивается и понимание эволюционного процесса в целом. Среди прочего весьма устойчива идея о том, что эволюция прогрессивна и однонаправленна (или даже предумышленна со стороны некоторых организмов, поскольку люди обычно не воспринимают идею естественного отбора). Или что все черты должны быть адаптивны (сексуальный отбор существует! и случайные мутации тоже!).

«Самый приспособленный» не значит «самый сильный» или «самый умный». Это означает «организм, лучше всего подходящий для жизни в определенной среде», и под этим может подразумеваться что угодно, в диапазоне от «самый маленький» или «самый податливый» до «самый ядовитый» или «лучше других обходящийся неделями без воды». Кроме того, живые существа не всегда эволюционируют в том направлении, которое мы могли бы объяснить адаптацией. Их эволюционный путь может быть сильнее связан со случайными мутациями или с теми чертами, которые представители их вида находят привлекательными.
Геологические мерки времени

Джилл, чьи работы посвящены изучению окружающей среды эпохи плейстоцена, существовавшей более 15 000 лет назад, говорит, что ее пугает, как мало людей понимает последовательность событий на Земле:

Проблема, с которой я часто сталкиваюсь, состоит в том, что людям не хватает понимания геологических временных рамок. Все доисторическое в сознании широких масс спрессовывается, и люди думают, что 20 000 лет назад на Земле существовали совершенно другие виды (нет!) или даже динозавры (нет! нет! нет!). Ситуацию не улучшает и то, что в упаковки с игрушечными динозаврами часто кладут пещерных людей или мамонтов.
Органический

По мнению энтомолога Гвен Пирсон, существует целая группа терминов, которые постоянно сопровождают слово «органический»: «без химикатов», «натуральный» и т. д. И ее уже воротит смотреть, насколько неправильно люди употребляют эти понятия:

Меня не столько расстраивает, что употребление этих слов формально неверно — поскольку, естественно, вся еда органическая, так как содержит углерод и т. д. Раздражает то, что они используются, чтобы свести на нет реальные различия в составе еды и в процессах производства. Что-то может быть «органическим» и при этом весьма опасным. А что-то может быть «синтетическим» и рукотворным, но безопасным, а порой и просто лучше, чем «естественное». Если вы принимаете инсулин, не исключено, что он произведен из генно-модифицированных бактерий. И по-прежнему спасает жизни.

Источник

25 сен 14, 08:00
+8 4

За колючим шлагбаумом. 5 мест, где ты должен побывать, но не сможешь.

 

 



Мы обнаружили на карте мира десять удивительных, незабываемых, невероятно интересных мест (для затравки перечислим в этой статье только пять), куда не стыдно мечтать попасть. Хотя бы потому, что ты туда никогда не попадешь. А значит, это будет мечта с неограниченным сроком годности!

1. Сухие долины
Если углубиться на территорию Антарктиды со стороны моря Росса, ты доберешься до трех так называемых «сухих долин» (Виктории, Райта и Тейлора). Здесь дуют катабатические ветра (самый быстрый ветер планеты, достигающий скорости 320 км/ч), которые вызывают повышенное испарение влаги. Таким образом, долины вот уже около 8 миллионов лет остаются свободны ото льда и снега. При этом в некоторых районах приблизительно 2 миллиона лет вообще не было никаких осадков.

Впрочем, вода в долинах все же присутствует — в виде самых соленых на Земле озер. Поскольку температура тут иногда поднимается до нуля, они местами оттаивают, придавая месту сюрреалистический вид тропического курорта. В самом крупном из этих озер полярники даже занимаются дайвингом. Говорят, на дне лежит мумифицировавшийся труп тюленя, который непонятным образом доковылял сюда с побережья.

Мертвый тюлень, пожалуй, единственный представитель местной фауны. Климат здесь настолько суровый, что даже бактерии представлены в весьма ограниченном количестве, не говоря уж о более многоклеточных организмах. Это, кстати, очень понравилось американским астрофизикам, которые приспособили сухие долины под испытания марсоходов. Они уверяют, что не только отсутствие лишней жизни, но и местный климат очень напоминает марсианский.

Теперь - о самом заманчивом. Почему ты сюда никогда не попадешь? Во-первых, антарктический туризм - вообще штука весьма условная. То есть за баснословные деньги ты, конечно, можешь купить экскурсию на Южный полюс (туда тебя доставят военным самолетом) или обзорный круиз по антарктическим островам, густо населенным пингвинами и тюленями. Прибавив сверху еще несколько тысяч, можно также зафрахтовать яхту и причалить где-нибудь на берегу моря Росса. Однако пройти пешком до сухих долин (около 50 километров по сугробам), сам понимаешь, не получится. Даже если у тебя вдруг завалялся частный самолет или вертолет, вряд ли он долетит туда и обратно без дозаправки из Чили или Новой Зеландии. А если и долетит, то уж точно не сядет.

2. Тайная камера
Неисследованные полости внутри пирамиды Хеопса. Правительство Египта блокирует попытки вскрыть их.

В марте 1993 года немецкий инженер Рудольф Гантенбринк проводил испытания своего нового робота-археолога внутри пирамиды Хеопса. Робот Упуат (что по-древнеегипетски значит «проводник в мир иной») был обучен пролезать в узкие шахты, недоступные для человека, и всячески исследовать их. В принципе, в пирамиде Хеопса таких шахт предостаточно: это вентиляционные каналы, с помощью которых в погребальной камере фараона, например, поддерживалась постоянная температура.

Рудольф запустил Упуата в шахту, выходящую из так называемой «камеры царицы» — ритуального помещения, в котором, впрочем, никакой царицы никогда не было. Сюрпризов не ожидалось: робот просто должен был выйти на поверхность (прочистив, кстати, канал, что, в принципе, полезно для микроклимата пирамиды). Однако вскоре после внедрения механического исследователя в тоннель египтологов мира чуть не хватил удар: Упуат уткнулся в дверь из белого известняка с металлическими деталями.

Это открытие тут же провозгласили «находкой десятилетия». Предполагалось, что за дверью находится та самая «тайная камера», о которой вот уже около столетия ходят археологические легенды! Например, американский исследователь пирамид Джон Киннаман перед смертью рассказывал, что в 1926 году ему удалось найти в пустыне засыпанный песком проход в некий «технический зал» пирамиды Хеопса, где он видел похожие на механизмы объекты. Однако власти запретили ему обнародовать это открытие и снова засыпали вход. Сравнительно недавно французские геофизики совершенно определенно обнаружили подозрительные пустоты внутри пирамиды Хеопса. И вот в 1993 году робот Гантенбринка вплотную приблизился к возможной двери в тайную камеру... И вдруг исследование было прекращено! Не объясняя причин, власти Египта запретили дальнейшее бурение.

На сегодняшний день «дверь Гантенбринка» — самая актуальная загадка пирамиды Хеопса. По поводу того, что находится за ней, строятся самые разные предположения: начиная от гробницы матери Хеопса, где хранятся несметные сокровища, и заканчивая ангаром, в котором оставили свою строительную технику инопланетяне. В любом случае, совершенно очевидно, что туристов туда пустят еще очень и очень нескоро.

3. Зона 51
Самый засекреченный американский авиаполигон, где, по слухам: а) хранятся остатки летающей тарелки, разбившейся в Розуэлле; б) снимали американцев на Луне; в) в подвалах томятся живые инопланетяне.

В конце 50-х годов на обширной территории возле озера Грум, с 1967 года фигурирующей в документах ЦРУ как «Зона 51», стали происходить странные вещи. Ее периметр огородили колючей проволокой, за которой началась кипучая деятельность. А потом местные жители стали замечать над озером весьма странные объекты. Они были похожи на серебряные блюдца, проносившиеся в утреннем небе с невероятной скоростью.

В общем-то, люди в Америке к тому времени уже были основательно подкованы насчет летающей посуды. В 1947 году всю страну облетела новость о Розуэлльском инциденте: фермер из Нью-Мексико обнаружил рядом со своим ранчо то, что военные поспешно назвали остатками высотного метеозонда, хотя, если верить хотя бы половине рассказов фермера, это была натуральная летающая тарелка с гуманоидами внутри. Естественно, жители Невады тут же решили, что розуэлльскую находку военные перетащили к ним, скопировали и теперь летают в свое удовольствие. Отрицать эти слухи никто не стал. Власти просто молчали. Даже сейчас нет официальной версии по поводу того, что расположено в Зоне 51. Американское правительство не отвечает ни на какие запросы и только в ходе судебных исков расплывчато признает, что возле озера Грум находится полигон ВВС. Впрочем, это очевидно: в квадрате 37 на 40 километров над озером строжайше запрещен пролет любой авиатехники под угрозой немедленного сбития. Журналистам также удалось раскопать тот факт, что в Зоне 51 проходили испытания сначала самолета-разведчика U-2, а затем сверхзвукового самолета А-12 (который, кстати, снизу чем-то напоминает блюдце).

И все же большинство фанатов Зоны 51 уверены, что самые замечательные самолеты-разведчики не стоят той секретности, которую правительство США поддерживает вокруг озера Грум. Например, в 2006 году историк Дуэйн Дей опубликовал записку анонимного сотрудника ЦРУ, который в 1974-м распекал американских астронавтов за то, что они все-таки сфотографировали «объект 51», хотя у них были строжайшие инструкции ни в коем случае не снимать именно его. Конечно, с тех пор прошло больше 30 лет, и сегодня снимки озера Грум из космоса можно с легкостью найти в Интернете. И все же Зону 51 до сих пор охраняют по периметру камуфлированные люди с М-16, а на сайте dreamlandresort всерьез собирают коллекцию фотографий легендарного «Белого автобуса», который каждое утро и вечер привозит конструкторов летающих тарелок на работу.

4. Северный Сентинельский остров
Последний остров на Земле, где обитают первобытные люди.

Формально Северный Сентинельский остров пребывает под индийской юрисдикцией (вместе с Андамановыми островами). Но на самом деле это, пожалуй, самая независимая территория на планете — по той причине, что ее жители не подозревают (и не желают подозревать) обо всем остальном мире. Племя сентинельцев считают последним из первобытных народов, которые никак не были затронуты цивилизацией.

Все дело в том, что изначально остров располагался на окраине торговых путей (вообще, на Андамановы острова ссылали каторжников) и никому не было особого дела до его покорения. Тем более что местное население, едва завидя проплывающие мимо корабли, тут же начинало их атаковать. В общем, с дикарями решили не связываться. В 60-х годах XX века, когда все остальные первобытные племена уже были основательно изучены, после чего интегрированы в цивилизацию, руки антропологов, наконец, дошли и до сентинельцев. На остров была отправлена лодка с дарами, полная оптимистичных ученых и фоторепортеров. Как и следовало ожидать, едва только лодка оказалась на расстоянии полета стрелы, как была немедленно атакована. Ученых это не смутило. Под градом стрел они подплыли к берегу, оставили на нем дары (свинью, куклу, кокосы, металлическую утварь и несколько пластиковых ведер) и с достоинством удалились.

Дары были встречены со сдержанным любопытством. Куклу и свинью тут же похоронили, красные ведра и металлическую утварь приняли с явным восторгом, а зеленые ведра отвергли с презрением. Однако принятые дары вовсе не расположили туземцев к дарителям. В следующий раз они опять встретили ученых градом стрел, причем некоторые члены племени (видимо, из особого презрения) начали совокупляться со своими женщинами прямо на глазах ант¬ропологов. Зрелище, безусловно, было весьма познавательным, однако ученые после этого все-таки решили оставить сентинельцев в покое.

С 90-х годов в среде антропологов стали культивировать более бережное отношение к первобытным народам (в конце концов, от большинства из них остались только воспоминания), и Северный Сентинельский остров окончательно объявили закрытой территорией. Теперь нравы и обычаи местного населения наблюдают исключительно с вертолета. Поэтому до сегодняшнего дня никому не известна ни численность сентинельского народа, ни его язык, ни культура.

На случай усиленного интереса со стороны искателей приключений и стрел на свою зад¬ницу правительство Индии предусмотрело в водах острова береговую охрану. То есть, если ты даже сможешь приблизиться к острову, то будешь арестован, оштрафован и отправлен восвояси. Кажется, сентинельцам все-таки удалось отстоять свою независимость от туристов.

Инцидент
В 2006 году в окрестностях острова появилась браконьерская лодка. Она принялась безжалостно лишать дикарей их законной рыбы, после чего естественным образом была атакована. Двое рыбаков, которые, скорее всего, даже не подозревали о грозящей им опасности, оказались убиты. Их тела попытались эвакуировать с помощью вертолета, однако под градом стрел тот даже не смог сесть. Скелеты рыбаков (слегка прикопанные для проформы песочком, однако ясно различимые) до сих пор белеют на берегу в назидание всем браконьерам и любопытным.

5. Менвит-Хилл
С воздуха эта штука выглядит как пасторально-зеленое поле, усыпанное огромными белыми яйцами. Это шарообразные кевларовые защитные колпаки над чувствительными спутниковыми антеннами. Официально полевая станция F-83 занимается обеспечением коммуникаций в Королевских ВВС Великобритании и ВВС США. А неофициально она пеленгует и расшифровывает огромный объем информации, передаваемой через коммерческие спутники всего мира.

По сути, базу Менвит-Хилл основали в 1954 году американцы. Это был самый разгар холодной войны. Естественно, крупную коммуникационную базу в такой близости от СССР почти сразу записали в шпионские. А вскоре ее соотнесли с похожими (но меньшей крупности) объектами в других капиталистических странах. Так родилась версия о глобальном проекте «Эшелон» — всемирной сети спутниковых антенн, пеленгующих советские переговоры. И опять же нет ничего удивительного в том, что ни британские, ни американские власти так и не подтвердили и не опровергли это предположение.

Известно, что база Менвит-Хилл всегда была одним из самых технически оснащенных объектов на территории Великобритании (например, здесь чуть ли не первыми получили появившиеся компьютеры IBM). В настоящий момент на территории базы около 25 спутниковых терминалов и около 20 квадратных километров помещений, набитых сложнейшей техникой. Пожалуй, это самое закрытое место в Великобритании.

Дополнительная информация
В 1947 году США и Англия заключили соглашение UKUSA, по которому они объединяли свои силы в сфере радиошпионажа. Целью было создание всемирной системы прослушивания (под всем миром в первую очередь подразумевался СССР). Вскоре к соглашению присоединилась Австралия, Канада и Новая Зеландия. Затем началась космическая эра, и «Эшелон» переквалифицировался на пеленг данных, передаваемых через спутники. Следует отметить, что ни одного официального признания существования проекта «Эшелон» нет.

 

 

 

 


Иван Р 8 сен 14, 15:42
+5 2

Пять вопросов о природе, на которые каждый должен знать ответы

 

 

 


Почему небо голубое? Сколько лет Земле? Когда погаснет Солнце? Что такое радуга? Из чего сделаны облака? Детские вопросы, над которыми бились крупнейшие умы в течение многих столетий.

Почему небо голубое?
Этот, на первый взгляд, детский вопрос уже в течение многих десятилетий постоянно задается студентам-физикам на экзамене по оптике. И хотя от будущих ученых ожидается развернутый ответ с применением сложных формул и графиков, простым смертным также не помешает иметь общее представление о цвете небосвода.

Небо кажется нам голубым из-за особенности рассеяния солнечных лучей. Ведь свет от солнца прежде чем достигнуть наших глаз, проходит через толщу земной атмосферы, заполненной различными газами и частицами, которые поглощают или рассеивают фотоны во все стороны.

Всем известно, что каждый луч солнечного света состоит из пучка световых волн всех цветов радуги. У синего света длина волны относительно короткая, поэтому ему легче пройти сквозь атмосферный фильтр, а значит, он будет и больше рассеиваться, окрашивая все небо в голубой оттенок.

Однако во время восхода или заката солнца, лучам приходится проходить гораздо большее расстояние, чтобы достичь нас. Из-за этого преимущество голубого света сходит на нет, и мы можем наблюдать вечернее небо окрашенным в багровые, оранжевые и желтые оттенки.

Сколько лет Земле?
Вокруг вопроса о возрасте Земли в течение многих столетий велись ожесточенные споры. Например, в 1654 году некий Джон Лайтфуд, проведя тщательные расчеты на основе Книги Бытия в Ветхом Завете, провозгласил, что Земля была создана ровно в 9 утра месопотамского времени, 26 октября 4004 года до Рождества Христова.

Интересную попытку оценить возраст Земли сделал граф де Бюффон в конце 18 века. Он смастерил миниатюрную копию планеты, затем подогрел ее и, наблюдая за скоростью естественного охлаждения мини-глобуса, пришел к выводу, что земному шару приблизительно 75 000 лет.

Уже в 19 веке знаменитый физик лорд Кельвин, используя различные уравнения, оценил возраст Земли в 20-40 миллионов лет.

Конец спорам между учеными положило открытие радиоактивности на рубеже 19 и 20 вв., которое предоставило геологам отличный инструмент для измерения возраста различных объектов.

Достаточно было определить на какой стадии распада находятся основные изотопы в объекте, а затем сравнить с таблицей, показывающей за какое время изотоп того или иного вещества распадается до такого состояния.

В настоящее время ученые оценивают возраст Земли в 4,54 миллиарда лет, с ошибкой менее чем один процент.

Когда погаснет Солнце?
Ответ: примерно через 5,5 млрд лет.
Примерно в это время у нашей звезды, которая представляет собой гигантский термоядерный реактор, в ядре закончится топливо, т. е. водород, и Солнце начнет использовать водород из своих внешних слоев.

Так начнется звездная агония, в процессе которой солнечное ядро будет сжиматься, а внешние слои быстро расширяться, превращая Солнце в красный гигант. Затем последует финальная вспышка, которая превратит бывшую солнечную систему в звездную сауну.

Разумеется, все ближайшие планеты, включая Землю, будут сожжены дотла еще на стадии красного гиганта.

Впрочем, конец человечества на Земле наступит значительно раньше. Уже через миллиард лет Солнце будет светить на 10% ярче, что вполне достаточно, чтобы выкипятить начисто все океаны, оставив нас без воды. К счастью, есть надежда, что к тому времени уже будет колонизирован Марс и спутники других планет.

Что такое радуга?
Этот прекрасный атмосферный феномен будоражил воображение людей еще в глубокой древности. Древние греки, например, считали радугу богиней Иридой, вестницей олимпийских богов.

Многие великие умы, от Аристотеля до Рене Декарта, допытывались до истоков процесса образования цветной арки на небе. Разумеется, что такое радуга, в наше время знают практически все.

Радуга образуется благодаря капелькам воды, остающимся в атмосфере после или во время дождя. Отражаясь от этих капелек, как от миниатюрных призм, солнечный свет разбивается на лучи с разными длинами волн, которые рефлектируют в нашу сторону.

Этот цветовой спектр доходит до наших глаз в виде арки со всеми цветами радуги, мягко переходящими друг в друга. Поскольку радуга – это отраженный солнечный свет, мы должны при ее наблюдении обязательно стоять спиной к солнцу.

Угол, под которым мы смотрим на радугу, составляет примерно 40 градусов – это угол отклонения солнечных лучей при отражении от водяных капель.

Из чего сделаны облака?
Разумеется, каждый знает, что облака состоят из капелек воды или ледяных кристаллов, а часто представляют собой смесь из того и другого.

Облака формируются, когда влажный теплый воздух поднимается над Землей. При подъеме большая часть влажного воздуха охлаждается, и водяной пар конденсируется, превращаясь в капли воды и кристаллы льда. Сила сцепления удерживает их вместе, и в результате образуется облако.

Облака – важная часть гидрологического цикла нашей планеты, при котором вода постоянно циркулирует между поверхностью Земли и атмосферой, постоянно переходя из жидкого состояния в газообразное, а иногда и в твердое.

 

 

 

 

 


Иван Р 8 сен 14, 15:40
0 0

Геномика: постановка задачи и методы секвенирования. Методы определения последовательности нуклеотидов в молекуле ДНК.


Сергей Николенко, сотрудник лаборатории вычислительной биологии Санкт-Петербургского Академического Университета, в серии статей говорит о некоторых задачах биоинформатики, связанных со сборкой и анализом геномов, делая акцент на математической, комбинаторной постановке задачи. В данном вводном тексте речь идет о том, как выглядят входные данные для сборки геномов и как их получают. 

Как выглядит молекула ДНК?

Начнем с того, как выглядит молекула ДНК. Молекулы полимеров характеризуются первичной структурой, под которой понимается просто состав молекулы (в данном случае – последовательность букв A, C, G и T, которые и составляют геном), вторичной структурой, т.е. тем, какие именно химические связи устанавливаются между этими компонентами и какие в результате получаются базовые пространственные структуры (в данном случае – двойная спираль), и третичной структурой, т.е. тем, как вторичная структура «уложена» в пространстве. Вторичная структура ДНК представляет собой двойную спираль, состоящую
из четырёх разных нуклеотидов. Нуклеотиды обозначаются по содержащимся в них азотистым основаниям: аденину (A), цитозину (C), гуанину (G) и тимину (T) (есть ещё урацил, который в РНК заменяет тимин), и в дальнейшем мы всегда будем пользоваться этими буквами. В двойной спирали эти аминокислоты связаны друг с другом водородными связями, и связь устанавливается по принципу комплементарности: если в одной нити ДНК стоит A, то в комплементарной нити будет T; а если в одной нити C, то в другой будет G. Именно это позволяет относительно просто проводить репликацию (копирование) ДНК, например, при делении клетки: для этого достаточно просто разорвать водородные связи, разделив двойную спираль на нити, после чего парная нить для каждого «потомка» автоматически соберётся правильно. Важно понять, что ДНК – это две копии одного и того же «текста» из четырёх «букв»; «буквы» в копиях не идентичны, но однозначно соответствуют друг другу. Например:

ATGCAGAACAGACGATCAGCGACACTTTA
TACGTCTTGTCTGCTAGTCGCTGTGAAAT

Было бы, конечно, удобно, если бы нам удалось аккуратно «вытянуть» одну нить ДНК и спокойно, нуклеотид за нуклеотидом, «прочесть» эту нить от начала до конца. При таком идеальном методе секвенирования (чтения ДНК) никаких хитрых алгоритмов не понадобилось бы. К сожалению, на данном этапе такое невозможно, и приходится довольствоваться результатами того секвенирования, которое есть.

Что такое секвенирование?

Секвенирование (sequencing) – это общее название методов, которые позволяют установить последовательность нуклеотидов в молекуле ДНК. В настоящее время нет ни одного метода секвенирования, который бы работал для молекулы ДНК целиком; все они устроены так: сначала готовится большое число небольших участков ДНК (клонируется молекула ДНК многократно и «разрезается» её в случайных местах), а потом читается каждый участок по отдельности.

Клонирование происходит либо просто выращиванием клеток в чашке Петри, либо (в случаях, когда это было бы слишком медленно или по каким-то причинам не получилось бы) при помощи так называемой полимеразной цепной реакции. В кратком и неточном изложении работает она примерно так: сначала ДНК денатурируют, т.е. разрушают водородные связи, получая отдельные нити. Затем к ДНК присоединяют так называемые праймеры; это короткие участки ДНК, к которым может присоединиться ДНК-полимераза – соединение, которое, собственно, и занимается копированием (репликацией) нити ДНК. На следующем этапе полимераза копирует ДНК, после чего процесс можно повторять: после новой денатурации отдельных нитей будет уже вдвое больше, на третьем цикле – вчетверо, и так далее.

Все эти эффекты достигаются в основном с помощью изменений температуры смеси из ДНК, праймеров и полимеразы; для наших целей важно, что это достаточно точный процесс, и ошибки в нём редки, а на выходе получается большое число копий участков одной и той же ДНК. Разные методы секвенирования отличаются друг от друга не методами клонирования, а тем, как потом прочесть получившийся «суп» из многочисленных копий одной и той же ДНК.

Секвенирование по Сэнгеру

Первым методом секвенирования, который учёные сумели применить для обработки целых геномов (в том числе генома человека), стало секвенирование по Сэнгеру (Sanger sequencing). Смысл таков: участок ДНК клонируется, после чего полученная смесь делится на четыре части. Каждая часть помещается в активную среду, где присутствуют:

(1) ДНК-полимераза, которая, как мы уже выяснили, занимается репликацией,

(2) праймеры, необходимые для начала процесса репликации,

(3) смесь всех четырёх нуклеотидов, которые будут служить «кирпичиками» для строительства новых копий ДНК,

(4) и, главное, специальные вариации одного из нуклеотидов (ровно один вид нуклеотидов для каждой части), которые прекращают дальнейшее копирование молекулы ДНК.

Собственно, процесс практически идентичен клонированию ДНК, с которым мы встретились в предыдущем разделе. Разница только в том, что теперь в один из нуклеотидов подмешаны «ложные» нуклеотиды; они могут образовать точно такую же водородную связь, но не могут продолжить свою нить дальше.

В результате в каждой части образуется большое число копий префиксов исследуемого участка ДНК, которые имеют разную длину, но всегда заканчиваются на одну и ту же букву – в зависимости от того, когда повезёт взять в процесс клонирования «ложный» нуклеотид. Например, в пробирке, где все последовательности заканчиваются на Т, из нашего примера выше получилась бы смесь из следующих префиксов:

ATGCAGAACAGACGATCAGCGACACTTTA (образец)
AT
ATGCAGAACAGACGAT
ATGCAGAACAGACGATCAGCGACACT
ATGCAGAACAGACGATCAGCGACACTT
ATGCAGAACAGACGATCAGCGACACTTT

Как теперь, получив такую смесь, «прочесть» геномную последовательность? Заметим, что в сумме в четырёх пробирках мы получили все возможные префиксы интересующего нас участка. Это значит, что если мы сможем просто измерить длину каждого префикса (точнее говоря, даже не измерить, а просто упорядочить, узнав, кто из них длиннее), то мы сможем узнать и последовательность тоже. Предположим, что мы увидели, что в пробирках лежат префиксы вот такой длины (по порядку, от самого лёгкого 1 до самого тяжёлого 10):A C G T
1, 5, 7, 8, 10 4, 9 3, 6 2

Очевидно, что эта последовательность начинается с А (т.к. самый лёгкий префикс, из одной буквы, заканчивается на A); дальше идёт C, дальше опять A, и так далее. В результате можно прочесть исходный участок: ATGCAGAACA.

А чтобы измерить длину, можно, например, измерить массу всех префиксов во всех пробирках. Чтобы измерить массу, можно, например (разные секвенаторы использовали разные процедуры, но суть от этого не меняется), ионизировать эти молекулы и отправить их наперегонки к заряженному электроду в специальном геле, который создаст трение и замедлит продвижение молекул – этот метод называется электрофорезом. При одинаковом заряде более тяжёлые молекулы будут двигаться медленнее, и в результате получится примерно такая картинка. Видно, что (в идеальном случае) можно просто прочесть последовательность нуклеотидов от самого лёгкого префикса (т.е. префикса из одной буквы) к самому тяжёлому.

Результаты и ошибки сэнгеровского секвенирования

На выходе из сэнгеровского секвенатора получаются короткие участки ДНК, так называемые риды (reads). Для биоинформатики принципиальны две вещи: во-первых, какой длины получаются риды, во-вторых, какие в них могут быть ошибки и как часто (разумеется, на свете нет ничего идеального).

Сэнгеровские риды по этим критериям очень хороши: получаются риды длиной около тысячи нуклеотидов, причём качество начинает заметно падать только после 700-800 нуклеотидов. Сам процесс секвенирования по Сэнгеру, с которым мы познакомились в предыдущем разделе, предопределяет и эффект падения качества (труднее отличить молекулу массой 700 от молекулы массой 701, чем массу 5 от массы 6), и другой неприятный эффект – если в геноме встречается длинная последовательность из одной и той же буквы (…AAAAAAAA…), трудно бывает точно определить, какой она длины – все промежуточные массы попадут в одну и ту же пробирку, некоторые из них могут не встретиться, некоторые — слиться друг с другом и т.д. Но всё же сэнгеровское секвенирование даёт отличные результаты с достаточно длинными ридами, которые потом относительно легко собирать. О том, как это делается, мы будем говорить в последующих текстах.

Именно при помощи сэнгеровского секвенирования был впервые расшифрован геном человека. Секвенирование по Сэнгеру применяется и сегодня, но его всё активнее вытесняют другие методы, и применяется оно всё реже. Кому же и почему оно уступило свои позиции?

Секвенаторы второго поколения: Illumina

Современные секвенаторы – это так называемые секвенаторы второго поколения (SGS, second generation sequencing). В них участки ДНК по-прежнему многократно клонируются, но процесс чтения устроен не так, как у Сэнгера. Существует много разных методов, отличающихся довольно существенно, поэтому мы рассмотрим только один из них, один из самых популярных на сегодня – секвенирование по методу Solexa (ныне Illumina; в смене названия не нужно искать глубокий смысл, просто одна компания купила другую).

Процесс секвенирования Illumina проиллюстрирован на рисунке; кроме того, можно посмотреть один из нескольких существующих видеороликов с анимацией этого процесса – в данном случае, действительно, лучше один раз увидеть, чем сто раз прочесть текст. Однако краткие комментарии тоже пригодятся; вот как происходит процесс секвенирования по методу Illumina.

(1) Копии ДНК разрезаются в случайных местах на большое число небольших участков.
(2) К каждому участку с двух сторон добавляют специальные адаптеры – заранее известные небольшие последовательности нуклеотидов.
(3) Затем полученная смесь помещается на специально подготовленную подложку, из которой в виде решётки «растут» участки ДНК, комплементарные адаптерам. Таким образом, они способны «привязать» снабжённые адаптерами участки ДНК к этим местам. Кроме того, адаптеры также содержат праймеры, участки, к которым может присоединиться ДНК-полимераза, которая осуществляет репликацию ДНК.
(4) На шаге 3 разные участки ДНК случайным образом «присасываются» к разным местам в решётке. Теперь мы многократно клонируем каждый участок вокруг своего места, получая тем самым целые «кластеры». Этот процесс известен как bridge amplification, потому что ДНК привязывается к подложке сразу двумя концами; о том, что это означает для биоинформатики, мы поговорим в следующем разделе.
(5) Участки ДНК денатурируют (разрушают водородные связи) – в результате из узлов решётки на подложке «растут» разные участки ДНК, состоящие из одной нити.
(6) Подложка помещается в раствор, содержащий ДНК-полимеразу и специально помеченные нуклеотиды, которые сразу же заканчивают процесс репликации (если помните, в сэнгеровском секвенировании такие тоже применялись). Они присоединяются к ДНК, по одному к каждому участку. Соответственно, к каждому участку присоединяется та «буква», с комплементарной к которой он начинается.
(7) Затем «лишние» нуклеотиды смывают, а метки оставшихся считывают; в технологии Illumina это флуоресцентные метки, которые можно заставить светиться разным цветом и сфотографировать. Именно на этом шаге мы и узнаём, с какой буквы начинается каждый «кластер участков» ДНК.
(8) После этого с уже связанных нуклеотидов химически «срезается» радикал, который мешал дальнейшей надстройке молекулы ДНК. Теперь можно вернуться на шаг 6 и повторить процесс, читая на втором цикле вторые буквы в каждой последовательности, и так далее.

В результате на каждом цикле мы прочитываем одновременно очень большое число нуклеотидов из разных последовательностей. Но за это приходится платить тем, что участки ДНК, которые мы можем прочесть, оказываются гораздо 


Иван Р 26 июл 14, 11:48
0 0
Темы с 11 по 20 | всего: 31
Самые обсуждаемые
Хватит перевирать науку

Хватит перевирать науку

Многие понятия покинули мир науки, и соответствующие слова стали частью повседневной речи — но, к сожалению, чаще всего их используют неправильно. Мы попросили н

25 сен 14, 08:00
+8 4
Французские вирусологи воскресили древнее сибирское зло возрастом 30 тысяч лет

Французские вирусологи воскресили древнее сибирское зло возрастом 30 тысяч лет

Научные сотрудники Университета Экс-Марсель, под руководством биологов-эволюционистов Жана-Мишеля Клавери и Шанталь Абергель сообщили о том, что успешно возроди

Иван Р 21 июн 14, 11:20
+6 6
Самый необычный человеческий мозг из известных науке

Самый необычный человеческий мозг из известных науке

Человеческий мозг до сих пор во многом остаётся загадкой, далеко не все его возможности и особенности функционирования понятны науке. Долгие годы ведутся исслед

Иван Р 24 июн 14, 11:09
+5 6
За колючим шлагбаумом. 5 мест, где ты должен побывать, но не сможешь.

За колючим шлагбаумом. 5 мест, где ты должен побывать, но не сможешь.

    Мы обнаружили на карте мира десять удивительных, незабываемых, невероятно интересных мест (для затравки перечислим в этой статье только

Иван Р 8 сен 14, 15:42
+5 2
Как моллюски создают жемчужину

Как моллюски создают жемчужину

Исследование проводилось группой специалистов из Франции, Французской Полинезии и Катара. Жемчужина образуется внутри раковины после попадания туда посторон

21 июл 15, 05:00
+3 0
Минусовые
Почему кожа морщится от воды?

Почему кожа морщится от воды?

Кратким ответом может служить следующий: этот вид морщин возникает из-за деформации верхнего слоя кожи и исчезновения защищающих ее натуральных масел. По с

20 мар 15, 04:30
0 0
Пять вопросов о природе, на которые каждый должен знать ответы

Пять вопросов о природе, на которые каждый должен знать ответы

      Почему небо голубое? Сколько лет Земле? Когда погаснет Солнце? Что такое радуга? Из чего сделаны облака? Детские вопросы, над которым

Иван Р 8 сен 14, 15:40
0 0
Память воды

Память воды

Что такое память воды?.. Все началось в одной из закрытых лабораторий Германии. Лаборантка случайно уронила в сосуд с дистиллированной водой запаянную ампулу

27 окт 14, 12:30
0 0
10 самых необычных ядов

10 самых необычных ядов

  Как и миллионы лет назад, на нашей планете ежедневно идет причудливый балет жизни и смерти, не останавливая свое движение ни на секунду. Каждый раз миллион

Иван Р 16 июн 14, 10:28
0 0
Геномика: постановка задачи и методы секвенирования. Методы определения последовательности нуклеотидов в молекуле ДНК.

Геномика: постановка задачи и методы секвенирования. Методы определения последовательности нуклеотидов в молекуле ДНК.

Сергей Николенко, сотрудник лаборатории вычислительной биологии Санкт-Петербургского Академического Университета, в серии статей говорит о некоторых задачах биои

Иван Р 26 июл 14, 11:48
0 0

Сейчас онлайн

  • Сергей Мелюс
  • ИЛЬЯ ХАХУЛИН
  • Юрий Меринов
  • Федор Карп
  • Петр Степанюга
  • Fedor Stepanov
  • Владимир Козлов
  • Inessa Saxonova
  • Ирина Зыкова
  • Gennady Semerov
  • Данияр Азимбаев
  • борис румянцев
  • Эдуард Волков
  • Подлубный Борис
  • Юлия Скворцова
Читать

Поиск по блогу

Последние комментарии